ID: 1169483488_1169483497

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1169483488 1169483497
Species Human (GRCh38) Human (GRCh38)
Location 20:6006403-6006425 20:6006436-6006458
Sequence CCGGCCGCTCTTGGCTTGCGGCT GGCCAGCGGAACCACTGTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 115} {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!