ID: 1169483523_1169483539

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1169483523 1169483539
Species Human (GRCh38) Human (GRCh38)
Location 20:6006513-6006535 20:6006556-6006578
Sequence CCCGGGCGGCCAGTGGGGCCCGG CGTACCGATGAGGCGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 416} {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!