ID: 1169611855_1169611860

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1169611855 1169611860
Species Human (GRCh38) Human (GRCh38)
Location 20:7389941-7389963 20:7389981-7390003
Sequence CCTAGATCACAGATTCCAGCATG TGATGGGACACACTCTGAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 12, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!