ID: 1169623812_1169623824

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1169623812 1169623824
Species Human (GRCh38) Human (GRCh38)
Location 20:7540151-7540173 20:7540200-7540222
Sequence CCACCAGCAGTGGAACATCATAG AGGGAGAGCAAGGTGATTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 41, 3: 105, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!