ID: 1169745159_1169745171

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1169745159 1169745171
Species Human (GRCh38) Human (GRCh38)
Location 20:8935835-8935857 20:8935888-8935910
Sequence CCACTTGGAACCCTGAGGACTGT ATCAGGATAGACCATCTGTCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 29, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!