ID: 1169780594_1169780600

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1169780594 1169780600
Species Human (GRCh38) Human (GRCh38)
Location 20:9306078-9306100 20:9306128-9306150
Sequence CCTCCATTGTCTCCATATAAGGT TATCTCTAACTTTTTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!