ID: 1169780599_1169780600

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1169780599 1169780600
Species Human (GRCh38) Human (GRCh38)
Location 20:9306113-9306135 20:9306128-9306150
Sequence CCTTTCTATTTTCTATATCTCTA TATCTCTAACTTTTTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 150, 4: 1394} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!