ID: 1169875397_1169875398

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1169875397 1169875398
Species Human (GRCh38) Human (GRCh38)
Location 20:10291763-10291785 20:10291786-10291808
Sequence CCAGGAGGCACAGGCATGCATGC ATGAAAATACAGATGAAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!