ID: 1169975099_1169975103

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1169975099 1169975103
Species Human (GRCh38) Human (GRCh38)
Location 20:11316419-11316441 20:11316433-11316455
Sequence CCACTCTGGTGATGCTGATTCAG CTGATTCAGCAGGTCTAGGGTGG
Strand - +
Off-target summary No data {0: 7, 1: 80, 2: 365, 3: 998, 4: 1981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!