ID: 1170033668_1170033677

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1170033668 1170033677
Species Human (GRCh38) Human (GRCh38)
Location 20:11968215-11968237 20:11968234-11968256
Sequence CCCCAACAGTGAGGAAGAACTGG CTGGAGACCCTGGTTGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 216} {0: 1, 1: 1, 2: 2, 3: 49, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!