ID: 1170075833_1170075837

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1170075833 1170075837
Species Human (GRCh38) Human (GRCh38)
Location 20:12417740-12417762 20:12417768-12417790
Sequence CCCCTGCTGTCTGCACTGTAATA AAGCGGATGTTCTCTGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!