ID: 1170102689_1170102691

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1170102689 1170102691
Species Human (GRCh38) Human (GRCh38)
Location 20:12719971-12719993 20:12719984-12720006
Sequence CCCAAAATTTACACGTTGAAGCT CGTTGAAGCTCTAACCCCCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!