ID: 1170107550_1170107552

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1170107550 1170107552
Species Human (GRCh38) Human (GRCh38)
Location 20:12767878-12767900 20:12767900-12767922
Sequence CCATCACTCTGCCAGAGGGACTG GACTTTCCCCCACCGCCTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!