ID: 1170207648_1170207650

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1170207648 1170207650
Species Human (GRCh38) Human (GRCh38)
Location 20:13816350-13816372 20:13816368-13816390
Sequence CCTTAGAGAATGAGGACAGGTAT GGTATACTGTTAGATGAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144} {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!