ID: 1170406741_1170406745

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1170406741 1170406745
Species Human (GRCh38) Human (GRCh38)
Location 20:16045859-16045881 20:16045889-16045911
Sequence CCTCCTTTACACTGCTACCTGAG TAATCCTCTTCCATACCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155} {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!