ID: 1170502763_1170502765

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1170502763 1170502765
Species Human (GRCh38) Human (GRCh38)
Location 20:16991577-16991599 20:16991599-16991621
Sequence CCTGTTGGTCCATAAAAAGCTGC CTGAAGTCACAGATTGACCATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 99} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!