ID: 1170525010_1170525019

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1170525010 1170525019
Species Human (GRCh38) Human (GRCh38)
Location 20:17228142-17228164 20:17228179-17228201
Sequence CCCGGCTACAGGAGCTGGAGAGG GATTCCCTACGGAGAAGTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 318} {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!