ID: 1170545919_1170545929

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1170545919 1170545929
Species Human (GRCh38) Human (GRCh38)
Location 20:17435866-17435888 20:17435891-17435913
Sequence CCCTGGAGAGGCCTTTGTGGATG CAAACGGGGACCGGAGGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!