ID: 1170568247_1170568255

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1170568247 1170568255
Species Human (GRCh38) Human (GRCh38)
Location 20:17618567-17618589 20:17618614-17618636
Sequence CCTGGCATGGGGACATGGAGGCC CTGTTTCTGGGCTTCGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 331} {0: 1, 1: 2, 2: 2, 3: 16, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!