ID: 1170571314_1170571322

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1170571314 1170571322
Species Human (GRCh38) Human (GRCh38)
Location 20:17634380-17634402 20:17634422-17634444
Sequence CCACCTCTCTGACTTGGGGGCTG GCCACACCAAAGCCCACTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 297} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!