ID: 1170572753_1170572766

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1170572753 1170572766
Species Human (GRCh38) Human (GRCh38)
Location 20:17641702-17641724 20:17641732-17641754
Sequence CCAGCATCTCGGAGCCCGGGATC GATGGGGCGGGGGTCCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 77} {0: 1, 1: 0, 2: 3, 3: 26, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!