ID: 1170572753_1170572769

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1170572753 1170572769
Species Human (GRCh38) Human (GRCh38)
Location 20:17641702-17641724 20:17641742-17641764
Sequence CCAGCATCTCGGAGCCCGGGATC GGGTCCTCTGAGGACGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 77} {0: 1, 1: 1, 2: 2, 3: 29, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!