ID: 1170645117_1170645133

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1170645117 1170645133
Species Human (GRCh38) Human (GRCh38)
Location 20:18190953-18190975 20:18190987-18191009
Sequence CCGCTCTGGCTAAGCCTTGGGGA GGTGTAGGGGGTAGTTTAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!