ID: 1170704498_1170704509

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1170704498 1170704509
Species Human (GRCh38) Human (GRCh38)
Location 20:18733132-18733154 20:18733176-18733198
Sequence CCCAGGTGTCCTCAGGGGGACTG CTCAGTGGGCAGAAGGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!