ID: 1170722744_1170722751

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1170722744 1170722751
Species Human (GRCh38) Human (GRCh38)
Location 20:18898193-18898215 20:18898218-18898240
Sequence CCCTACTGTGATGGTATTAGGAG GGGGCCTTTGGTAAATGATTAGG
Strand - +
Off-target summary {0: 1, 1: 30, 2: 306, 3: 1149, 4: 2170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!