ID: 1170732666_1170732672

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1170732666 1170732672
Species Human (GRCh38) Human (GRCh38)
Location 20:18988192-18988214 20:18988240-18988262
Sequence CCCAGGAAACACAGGCAGTCCAC TGCTACATGCTGACCAGGCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!