ID: 1170756939_1170756949

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1170756939 1170756949
Species Human (GRCh38) Human (GRCh38)
Location 20:19212999-19213021 20:19213022-19213044
Sequence CCTGCCCCGAGTGGGCGCTGCGG CTCCGGCGGCTCGGGGCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193} {0: 1, 1: 0, 2: 2, 3: 28, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!