ID: 1170780821_1170780831

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1170780821 1170780831
Species Human (GRCh38) Human (GRCh38)
Location 20:19423863-19423885 20:19423897-19423919
Sequence CCACAACAGAGTGCATGATACGA ACCCAAGCCTGGAGGGGTAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 44, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!