ID: 1170780821_1170780835

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1170780821 1170780835
Species Human (GRCh38) Human (GRCh38)
Location 20:19423863-19423885 20:19423901-19423923
Sequence CCACAACAGAGTGCATGATACGA AAGCCTGGAGGGGTAGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 93, 4: 831}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!