ID: 1170787566_1170787574

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1170787566 1170787574
Species Human (GRCh38) Human (GRCh38)
Location 20:19480766-19480788 20:19480816-19480838
Sequence CCAGTGAACTCAATCTAAGAGCT CCTGGGACACTGATCCTTACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!