ID: 1170857863_1170857867

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1170857863 1170857867
Species Human (GRCh38) Human (GRCh38)
Location 20:20074075-20074097 20:20074092-20074114
Sequence CCTGTTTCCTTAAATAATTGTGA TTGTGAGTAAGGAGGACAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 34, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!