ID: 1170919848_1170919856

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1170919848 1170919856
Species Human (GRCh38) Human (GRCh38)
Location 20:20667714-20667736 20:20667763-20667785
Sequence CCTGGAGTGCACTGAAACTGTTT GAGAAAGGTTGAAGGTGTGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!