ID: 1170969691_1170969707

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1170969691 1170969707
Species Human (GRCh38) Human (GRCh38)
Location 20:21105282-21105304 20:21105305-21105327
Sequence CCCCCGCCCCCCACCCCAAGGTG TTGTTTCCTAGGGTCTTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 150, 4: 1179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!