ID: 1170977155_1170977162

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1170977155 1170977162
Species Human (GRCh38) Human (GRCh38)
Location 20:21175708-21175730 20:21175753-21175775
Sequence CCTTAGTTAAGTCTCTAGGAGGC CCTATAATCCCCAACACTTTGGG
Strand - +
Off-target summary No data {0: 3, 1: 63, 2: 393, 3: 803, 4: 1406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!