ID: 1170991145_1170991148

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1170991145 1170991148
Species Human (GRCh38) Human (GRCh38)
Location 20:21303096-21303118 20:21303109-21303131
Sequence CCCGCAACTCAGACGCGCTCGGC CGCGCTCGGCCTCGCGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26} {0: 1, 1: 0, 2: 4, 3: 16, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!