ID: 1171088992_1171088995

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1171088992 1171088995
Species Human (GRCh38) Human (GRCh38)
Location 20:22266589-22266611 20:22266609-22266631
Sequence CCTGGGTGGTTGCTAAAAAACAC CACTCAAAGGCCAAGCATGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 105, 4: 950}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!