ID: 1171123624_1171123636

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1171123624 1171123636
Species Human (GRCh38) Human (GRCh38)
Location 20:22584584-22584606 20:22584607-22584629
Sequence CCGAGGCGGCGGGAAGCGCGCGG CGCGGGGGCTAGTGGGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116} {0: 1, 1: 0, 2: 1, 3: 24, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!