ID: 1171123624_1171123645

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1171123624 1171123645
Species Human (GRCh38) Human (GRCh38)
Location 20:22584584-22584606 20:22584631-22584653
Sequence CCGAGGCGGCGGGAAGCGCGCGG GAGGAGGAGGAGGAAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116} {0: 50, 1: 287, 2: 939, 3: 2937, 4: 9261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!