ID: 1171211760_1171211766

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1171211760 1171211766
Species Human (GRCh38) Human (GRCh38)
Location 20:23322239-23322261 20:23322263-23322285
Sequence CCTCCCACTTCAAAATAATCGGG GTTCTGTTCCTAAGGAAAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 77, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!