ID: 1171252009_1171252016

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1171252009 1171252016
Species Human (GRCh38) Human (GRCh38)
Location 20:23655920-23655942 20:23655958-23655980
Sequence CCTTCTTTTCACTTCCTCACTGA CCAGACCTCTCCCACCCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 567} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!