ID: 1171292507_1171292515

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1171292507 1171292515
Species Human (GRCh38) Human (GRCh38)
Location 20:23990323-23990345 20:23990373-23990395
Sequence CCCACGTTGGGGTCACTACTAGA GCCTCAGCCACAGCTGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 0, 3: 19, 4: 34} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!