ID: 1171325061_1171325064

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1171325061 1171325064
Species Human (GRCh38) Human (GRCh38)
Location 20:24283928-24283950 20:24283944-24283966
Sequence CCACCCTCACACTGCTATAAAGA ATAAAGACATACCTGAGACTAGG
Strand - +
Off-target summary {0: 1, 1: 34, 2: 936, 3: 2722, 4: 3573} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!