ID: 1171340520_1171340524

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1171340520 1171340524
Species Human (GRCh38) Human (GRCh38)
Location 20:24423505-24423527 20:24423545-24423567
Sequence CCTCCACCTCAGGAGCGCTGTGA CGTCCTGATGTTCCTAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 196} {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!