ID: 1171371735_1171371741

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1171371735 1171371741
Species Human (GRCh38) Human (GRCh38)
Location 20:24666764-24666786 20:24666787-24666809
Sequence CCTAATCCCCTCAGTGGACACAG AGACCCCCTCTCCAGGACGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 212} {0: 1, 1: 0, 2: 1, 3: 16, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!