ID: 1171378453_1171378458

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1171378453 1171378458
Species Human (GRCh38) Human (GRCh38)
Location 20:24713014-24713036 20:24713032-24713054
Sequence CCACCCCTTTACCTTAAGTTTAT TTTATGAGACCTTATATGTTAGG
Strand - +
Off-target summary {0: 188, 1: 446, 2: 399, 3: 274, 4: 531} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!