ID: 1171378454_1171378461

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1171378454 1171378461
Species Human (GRCh38) Human (GRCh38)
Location 20:24713017-24713039 20:24713061-24713083
Sequence CCCCTTTACCTTAAGTTTATGAG TCTTAAAGGCAGCAGATACTTGG
Strand - +
Off-target summary {0: 7, 1: 277, 2: 436, 3: 355, 4: 391} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!