ID: 1171396217_1171396230

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1171396217 1171396230
Species Human (GRCh38) Human (GRCh38)
Location 20:24835449-24835471 20:24835497-24835519
Sequence CCCTTCACCATGATCCAGTGAGA CGGAGGTAGGAAAAGGAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 34, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!