ID: 1171396222_1171396236

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1171396222 1171396236
Species Human (GRCh38) Human (GRCh38)
Location 20:24835463-24835485 20:24835513-24835535
Sequence CCAGTGAGACAGGAGAGAGGTTG AGCGAGGAGGGCAGGAGATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 14, 3: 80, 4: 798}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!