ID: 1171396635_1171396639

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1171396635 1171396639
Species Human (GRCh38) Human (GRCh38)
Location 20:24838694-24838716 20:24838720-24838742
Sequence CCACATGGACTCTGGTTGTCTTC AAGAAGGCTGGCCCTGCACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!