ID: 1171416426_1171416431

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1171416426 1171416431
Species Human (GRCh38) Human (GRCh38)
Location 20:24984127-24984149 20:24984162-24984184
Sequence CCCACTGCAAGCTGGCCGACCTC AAACTCTAGCACTATTTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 91} {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!